View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9653_low_55 (Length: 242)
Name: NF9653_low_55
Description: NF9653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9653_low_55 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 34 - 229
Target Start/End: Complemental strand, 34381520 - 34381325
Alignment:
| Q |
34 |
tagaactcatgtcaaccttacaagtgttgctggttgaaagatcatattagtagctctagtgtcgggttgtttttcttattgtggctgttaattactactc |
133 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34381520 |
tagaactcatgttaaccttacaagtgttgctggttgaaagatcatattagtagctctagtgtcgggttgtttttcttattgtggctgttaattactactc |
34381421 |
T |
 |
| Q |
134 |
aagtatatcaaatctactagtgtaagtatgcccgtaaaaaacctagaagcgatgttgtaaattatcaaagttacttacctctaagttttgtgatct |
229 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34381420 |
aagtatatcaaatctactagcgtaagtatgcccgtaaaaaacctagaagcgatgttataaattatcaaagttacttacctctaagttttgtgatct |
34381325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University