View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9653_low_62 (Length: 239)

Name: NF9653_low_62
Description: NF9653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9653_low_62
NF9653_low_62
[»] chr2 (2 HSPs)
chr2 (154-222)||(39185671-39185739)
chr2 (10-77)||(39185531-39185598)
[»] chr6 (1 HSPs)
chr6 (144-222)||(2101442-2101520)


Alignment Details
Target: chr2 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 154 - 222
Target Start/End: Original strand, 39185671 - 39185739
Alignment:
154 gatgattcacctctctgttgtttccacgactcatgatttttctactctttttctgtttttgctcaaatg 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39185671 gatgattcacctctctgttgtttccacgactcatgatttttctactctttttctgtttttgctcaaatg 39185739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 10 - 77
Target Start/End: Original strand, 39185531 - 39185598
Alignment:
10 cagaaatatcgtaaaaccctaacgtttctctaaagaaacgatcgtgactaaatgcaaacgaaaatagt 77  Q
    ||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||    
39185531 cagaaatatcgtaaaaccctaacatttctctaaagaaacgatcgcgactaaatgcaaacgaaaatagt 39185598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 144 - 222
Target Start/End: Complemental strand, 2101520 - 2101442
Alignment:
144 gaagatgatggatgattcacctctctgttgtttccacgactcatgatttttctactctttttctgtttttgctcaaatg 222  Q
    ||||| |||| | ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
2101520 gaagaagatgaacgattcacctctctgttgtttccacgactcatgatttttctactctttttatgtttttgctcaaatg 2101442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University