View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9653_low_68 (Length: 232)
Name: NF9653_low_68
Description: NF9653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9653_low_68 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 17 - 217
Target Start/End: Complemental strand, 33385059 - 33384859
Alignment:
| Q |
17 |
tgttatatattagttgatcattatttggtacaattgtatgttggtttttggtctgttgtatttttgcactagtgtaacaattattactgctaatatgcta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33385059 |
tgttatatattagttgatcattatttggtacaattgtatgttggtttttggtctgttgtatttttgcactagtgtaacaattattactgctaatatgcta |
33384960 |
T |
 |
| Q |
117 |
tgcagagctgatatgtgcaaatgtacaatcattctactataaatggcttatgttagtttctagatgttgtgattcaaatcacaattgtaggtgtgatatg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33384959 |
tgcagagctgatatgtgcaaatgtacaatcattctactaaaaatggcttatgttagtttctagatgttgtgattcaaatcacaattgtaggtgtgatatg |
33384860 |
T |
 |
| Q |
217 |
t |
217 |
Q |
| |
|
| |
|
|
| T |
33384859 |
t |
33384859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University