View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9653_low_70 (Length: 231)
Name: NF9653_low_70
Description: NF9653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9653_low_70 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 219
Target Start/End: Original strand, 51015332 - 51015533
Alignment:
| Q |
18 |
actccattcatcttgatcaccaacagcataaacactagccatgacacagttcaagagaaaactacatagcaaaataagaattgagagtatgaaggtacag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51015332 |
actccattcatcttgatcaccaacagcataaacactagccatgacacagttcaagagaaaactacatagcaaaataagaattgaaagtatgaaggtacag |
51015431 |
T |
|
| Q |
118 |
ttgttgaagaaatttgtgatcaccatttctttgaaaaagtaagaaagaagatgtgatgaaacagtggctgaaataatggtaggttgccacttgccacagg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
51015432 |
ttgttgaagaaatttgtgatcaccatttctttgaaaaagtaagaaagaagatgtgatgaaacagtggctgaaataatggtgggttgccacttgctacagg |
51015531 |
T |
|
| Q |
218 |
tt |
219 |
Q |
| |
|
|| |
|
|
| T |
51015532 |
tt |
51015533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University