View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9654_low_14 (Length: 242)
Name: NF9654_low_14
Description: NF9654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9654_low_14 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 45790038 - 45789797
Alignment:
| Q |
1 |
attgtatggtttagacacttgtatcaaaccttaatcctccccaattatnnnnnnnnnnnnnnnnnnnnccttgaagagggaaatctcggaaggtagtgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45790038 |
attgtatggtttagacacttgtatcaaaccttaatcctccccaattataaaaacacaaaacaaaaaaaccttgaagagggaaatctcggaaggtagtgac |
45789939 |
T |
|
| Q |
101 |
agtgattccttggacgaaatctctcaattcgtctgtaatgccgaaactctcaaaattgggattgatatcgacatcgttgttgaatgaaggttcagccaaa |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45789938 |
agtgattcctttgacgaaatctctcaattcgtctgtaatgccgaaactctcaaaattgggattgatatcgacatcgttgttgaatgaaggttcaaccaaa |
45789839 |
T |
|
| Q |
201 |
tggatggaagcttgtgccacgatccccttggcagtctctgct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45789838 |
tggatggaagcttgtgccacgatccccttggcattctctgct |
45789797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University