View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9654_low_18 (Length: 226)
Name: NF9654_low_18
Description: NF9654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9654_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 211
Target Start/End: Complemental strand, 10174416 - 10174219
Alignment:
| Q |
14 |
cagagatcaataaaatgaggtctatttctgaggatatttctcaatatggctttgtgcgtcgtgtttggttgcgtatgacccgaaagctaccaccttcttt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10174416 |
cagagatcaataaaatgaggtctatttctgaggatatttctcaatatggctttgtgcgtcgtgtttggttgtgtatgacccgaaagctaccaccttcttt |
10174317 |
T |
 |
| Q |
114 |
atctcatttagatgaattgaattgggagattttgattgtgaccggtgatgatgttactgattattttgctatagtttgctcgggagggaagattattg |
211 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10174316 |
gtctcatttggatgaattgaattgggagattttgattgtgaccggtgatgatgttactgattattttgctatagtttgctcgggagggaagattattg |
10174219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 14 - 160
Target Start/End: Complemental strand, 1238769 - 1238623
Alignment:
| Q |
14 |
cagagatcaataaaatgaggtctatttctgaggatatttctcaatatggctttgtgcgtcgtgtttggttgcgtatgacccgaaagctaccaccttcttt |
113 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||| || ||||||||| ||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1238769 |
cagagatcaacaaattgaggtctatttctgaggatatttcacagtatggctttttgcatcgtgtttggttgcgtatgacacgaaagctaccaccttcttt |
1238670 |
T |
 |
| Q |
114 |
atctcatttagatgaattgaattgggagattttgattgtgaccggtg |
160 |
Q |
| |
|
|||||||| |||| ||||||||||||| ||||||| ||||| |||| |
|
|
| T |
1238669 |
gtctcatttggatggattgaattgggaggttttgatcgtgactggtg |
1238623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 160
Target Start/End: Original strand, 1173945 - 1174091
Alignment:
| Q |
14 |
cagagatcaataaaatgaggtctatttctgaggatatttctcaatatggctttgtgcgtcgtgtttggttgcgtatgacccgaaagctaccaccttcttt |
113 |
Q |
| |
|
|||||||||| ||| |||||||||||||||| ||||||||||| ||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1173945 |
cagagatcaacaaattgaggtctatttctgatgatatttctcagtatggcttttggcaccgtgtttggttgcgtatgacccgaaagctaccaccttcttt |
1174044 |
T |
 |
| Q |
114 |
atctcatttagatgaattgaattgggagattttgattgtgaccggtg |
160 |
Q |
| |
|
|||||||| |||| ||||||||||||| ||||||| ||||| |||| |
|
|
| T |
1174045 |
gtctcatttggatggattgaattgggaggttttgatcgtgactggtg |
1174091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University