View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9654_low_19 (Length: 218)
Name: NF9654_low_19
Description: NF9654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9654_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 17 - 202
Target Start/End: Complemental strand, 34426996 - 34426811
Alignment:
| Q |
17 |
cagagaggtataaactatgaaatattatctcatatcttgattaactttgtactcctgatgtcaaacatcctgtgccctttatgtgattgacaatgcaaat |
116 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34426996 |
cagagaggtataaactatgaattattatctcatatcttgattaactttgtactactgatgtcaaacatcctgtgccctttatgtgattgacaatgcaaat |
34426897 |
T |
 |
| Q |
117 |
gaacagcatgaaatttgatgttgcctcaaccttaaatattgtagctttttagataatcctttcttgacttgaccaatggtctcaga |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34426896 |
gaacagcatgaaatttgatgttgcctcaaccttaaatattgtagcttgttagataatcctttcttgacttgaccaatggtctcaga |
34426811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University