View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9655_low_2 (Length: 267)
Name: NF9655_low_2
Description: NF9655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9655_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 25 - 254
Target Start/End: Complemental strand, 37513813 - 37513578
Alignment:
| Q |
25 |
acgtacacttatgttacgagcggtcttcaaatactcagcgacgaccttttcttcagcctcttctttttctctcacgactctattcttataaacaaagcgc |
124 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37513813 |
acgtacacttatgttaagagcggtcttcaaatactcagcgacggccttttcttcagcctcttctttttctctcacgactctattcttataaacaaagcgc |
37513714 |
T |
 |
| Q |
125 |
gtacacgaaaaatagcggggaatagggtcatcttcatacttgtcctgaagatattcaattggtttcgatacccagtcccaatcaattggt------tccg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37513713 |
gtacacgaaaaatagcggggaatagggtcatcttcatacttgtcctgaagatattcaattggtttcgatacccagtcccaatcaattggttccggttccg |
37513614 |
T |
 |
| Q |
219 |
aatcagattccgaatccgattccggttccgttttct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
37513613 |
aatcagattccgaatccgattccggttccgttttct |
37513578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University