View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9655_low_6 (Length: 254)
Name: NF9655_low_6
Description: NF9655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9655_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 32769689 - 32769911
Alignment:
| Q |
18 |
agaggcgtggtgaatcatgtatgcactttcttggaagctacttctagccagccattcattttattagtg-gtagttgaaaactaaacttacgaggcttga |
116 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||| |
|
|
| T |
32769689 |
agaggcgtggtgaatcatgtatgcacattcttggaagctacttctagccagccattcattttattagtgtgtagatgaaaactaaacttaggaggcttga |
32769788 |
T |
|
| Q |
117 |
acaatagctgtataagctttcagtcctaaactc----tatttatgaactatggtagnnnnnnnnnaccaatattggtttactatatccttttggtcaata |
212 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32769789 |
acaatagccgtataagctttcagtcttaaactctctttatttatgaactatggta--ctttttttaccaatattggtttactatatccttttggtcaata |
32769886 |
T |
|
| Q |
213 |
agtttagtcttggtaagtcagtggt |
237 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
32769887 |
agtttattcttggtaagtcagtggt |
32769911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University