View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9656_high_14 (Length: 344)
Name: NF9656_high_14
Description: NF9656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9656_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 4e-32; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 34 - 125
Target Start/End: Original strand, 40340798 - 40340893
Alignment:
| Q |
34 |
aaggatcactcgaataaaatctt----caagaaacagaaaatgggtacaacccattccaattccagctatataacataaaacccaaaacaatattt |
125 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40340798 |
aaggatcactcaaataaaatctttatacaagaaacagaaaatgggtacaacccattccaattccagctatataacataaaacccaaaataatattt |
40340893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 276 - 340
Target Start/End: Original strand, 40341044 - 40341108
Alignment:
| Q |
276 |
catgcatgtccgttagtggtgaacttgtccctttcatttgtgtcgttttgctgtctctgcttctc |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
40341044 |
catgcatgtccgttagtggtgaacttgtccctttcatttgtgtcgttttgctgtttctggttctc |
40341108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University