View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9656_high_40 (Length: 216)

Name: NF9656_high_40
Description: NF9656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9656_high_40
NF9656_high_40
[»] chr1 (1 HSPs)
chr1 (14-198)||(861787-861971)
[»] chr3 (2 HSPs)
chr3 (115-187)||(11093562-11093634)
chr3 (143-187)||(46801752-46801796)
[»] chr7 (1 HSPs)
chr7 (151-196)||(21509696-21509741)
[»] chr2 (1 HSPs)
chr2 (125-186)||(16461682-16461743)
[»] chr8 (1 HSPs)
chr8 (161-193)||(6501481-6501513)


Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 14 - 198
Target Start/End: Original strand, 861787 - 861971
Alignment:
14 atggtggtcagtgttttcatgtgccatttttgttggtgtagcagatttttgagaatgaggttttcatgtgtccggtattcgagatgtgttactgtctgac 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||    
861787 atggtggtcagtgttttcatgtgccatttttgttggtgtagcagatttttgagattgaggttttcatgtgtctggtattcgagatgtgttactgtctgac 861886  T
114 atgacacgaccccaacacacgtgactactttcaattttgccattttttcaaattattaccagtgtcaacgtgtctatgtcgtttc 198  Q
    | |||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||    
861887 acgacacgaccccatcacacgtgactactttcaattttgtcattttttcaaattattactagtgtcaacgtgtctatgtcgtttc 861971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 115 - 187
Target Start/End: Complemental strand, 11093634 - 11093562
Alignment:
115 tgacacgaccccaacacacgtgactactttcaattttgccattttttcaaattattaccagtgtcaacgtgtc 187  Q
    ||||||||| ||||||||  ||| |||||| |||| || |||||||||||||||||| |||||| || |||||    
11093634 tgacacgacaccaacacatctgattactttgaattatgtcattttttcaaattattatcagtgtaaatgtgtc 11093562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 143 - 187
Target Start/End: Original strand, 46801752 - 46801796
Alignment:
143 ttcaattttgccattttttcaaattattaccagtgtcaacgtgtc 187  Q
    |||||||||| |||||  ||||||||||| |||||||||||||||    
46801752 ttcaattttgtcatttactcaaattattatcagtgtcaacgtgtc 46801796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 151 - 196
Target Start/End: Original strand, 21509696 - 21509741
Alignment:
151 tgccattttttcaaattattaccagtgtcaacgtgtctatgtcgtt 196  Q
    |||||||||||| ||||||||| |||||||| ||||| ||||||||    
21509696 tgccattttttccaattattactagtgtcaatgtgtcgatgtcgtt 21509741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 125 - 186
Target Start/End: Complemental strand, 16461743 - 16461682
Alignment:
125 ccaacacacgtgactactttcaattttgccattttttcaaattattaccagtgtcaacgtgt 186  Q
    ||||||||||||| ||| || |||||||||||||| | ||||||||||  | ||||||||||    
16461743 ccaacacacgtgattacattaaattttgccattttattaaattattactggcgtcaacgtgt 16461682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Complemental strand, 6501513 - 6501481
Alignment:
161 tcaaattattaccagtgtcaacgtgtctatgtc 193  Q
    ||||||||||||||||||||||||||| |||||    
6501513 tcaaattattaccagtgtcaacgtgtcaatgtc 6501481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University