View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9656_high_7 (Length: 409)
Name: NF9656_high_7
Description: NF9656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9656_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 16 - 341
Target Start/End: Original strand, 5752007 - 5752333
Alignment:
| Q |
16 |
atattgttagtcacgatgagcatgttatgcacattgcttatccttgttagttgttacttcactctatacactatttgaggttatgataactaaccattta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5752007 |
atattgttagtcacgatgagcatgttatgcacattgcttatccttgttagttgttacttcactctatacactatttgaggttatgatgactaaccattta |
5752106 |
T |
 |
| Q |
116 |
tgtggctatacatacatatccaacccaatgtgatatgcatagatgatgaattgtaggtc-ttggggatgttgatgccttgccagacgtaataactcgttt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5752107 |
tgtggctatacatacatatccaacccaatgtgatattcataaatgatgaattgtaggtctttggggatgttgatgccttgccaaacgtaataactcgttt |
5752206 |
T |
 |
| Q |
215 |
gattagatatgagtggagagcgtaaaattgtattgtcacaaatgactttcagttgattgattgactatcaatcaactatcgatgttcttaacatttctga |
314 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |||||| |||||||||||||||| ||| |
|
|
| T |
5752207 |
gattagatatgagtgaagagcgtaaaattgtattgtcacaaatgactttcaattggttgattgactatcaattaactatggatgttcttaacatttttga |
5752306 |
T |
 |
| Q |
315 |
ttttaagagaatgtatgtttatccata |
341 |
Q |
| |
|
|||||| |||||||||||||||||||| |
|
|
| T |
5752307 |
ttttaaaagaatgtatgtttatccata |
5752333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University