View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9656_low_101 (Length: 216)
Name: NF9656_low_101
Description: NF9656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9656_low_101 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 14 - 198
Target Start/End: Original strand, 861787 - 861971
Alignment:
| Q |
14 |
atggtggtcagtgttttcatgtgccatttttgttggtgtagcagatttttgagaatgaggttttcatgtgtccggtattcgagatgtgttactgtctgac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
861787 |
atggtggtcagtgttttcatgtgccatttttgttggtgtagcagatttttgagattgaggttttcatgtgtctggtattcgagatgtgttactgtctgac |
861886 |
T |
 |
| Q |
114 |
atgacacgaccccaacacacgtgactactttcaattttgccattttttcaaattattaccagtgtcaacgtgtctatgtcgtttc |
198 |
Q |
| |
|
| |||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
861887 |
acgacacgaccccatcacacgtgactactttcaattttgtcattttttcaaattattactagtgtcaacgtgtctatgtcgtttc |
861971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 115 - 187
Target Start/End: Complemental strand, 11093634 - 11093562
Alignment:
| Q |
115 |
tgacacgaccccaacacacgtgactactttcaattttgccattttttcaaattattaccagtgtcaacgtgtc |
187 |
Q |
| |
|
||||||||| |||||||| ||| |||||| |||| || |||||||||||||||||| |||||| || ||||| |
|
|
| T |
11093634 |
tgacacgacaccaacacatctgattactttgaattatgtcattttttcaaattattatcagtgtaaatgtgtc |
11093562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 143 - 187
Target Start/End: Original strand, 46801752 - 46801796
Alignment:
| Q |
143 |
ttcaattttgccattttttcaaattattaccagtgtcaacgtgtc |
187 |
Q |
| |
|
|||||||||| ||||| ||||||||||| ||||||||||||||| |
|
|
| T |
46801752 |
ttcaattttgtcatttactcaaattattatcagtgtcaacgtgtc |
46801796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 151 - 196
Target Start/End: Original strand, 21509696 - 21509741
Alignment:
| Q |
151 |
tgccattttttcaaattattaccagtgtcaacgtgtctatgtcgtt |
196 |
Q |
| |
|
|||||||||||| ||||||||| |||||||| ||||| |||||||| |
|
|
| T |
21509696 |
tgccattttttccaattattactagtgtcaatgtgtcgatgtcgtt |
21509741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 125 - 186
Target Start/End: Complemental strand, 16461743 - 16461682
Alignment:
| Q |
125 |
ccaacacacgtgactactttcaattttgccattttttcaaattattaccagtgtcaacgtgt |
186 |
Q |
| |
|
||||||||||||| ||| || |||||||||||||| | |||||||||| | |||||||||| |
|
|
| T |
16461743 |
ccaacacacgtgattacattaaattttgccattttattaaattattactggcgtcaacgtgt |
16461682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 193
Target Start/End: Complemental strand, 6501513 - 6501481
Alignment:
| Q |
161 |
tcaaattattaccagtgtcaacgtgtctatgtc |
193 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
6501513 |
tcaaattattaccagtgtcaacgtgtcaatgtc |
6501481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University