View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9656_low_106 (Length: 205)
Name: NF9656_low_106
Description: NF9656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9656_low_106 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 35277712 - 35277506
Alignment:
| Q |
1 |
caaactccgaaacaatctaatcaaaccttcatgtatataaatagtgaaatatatttgaattcaat-------------catttaaaataacccaatgata |
87 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35277712 |
caaactccgaaacaatctagtcaaaccttcatgtatataaatagtgaaatatatttgaattcaatttacaaattcaatcatttaaaataacccaatgata |
35277613 |
T |
|
| Q |
88 |
aaatctactgtttgcaaaaataatgtttatagaccaaacttgattgctataactatagaaacaaaaacaaataaaaacatggattagatttaccttattg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
35277612 |
aaatctactgtttgcaaaaataatgtttatagaccaaacttgattgctataactatagaaacaaagacaaataaaaacatggtttagatttaccttattg |
35277513 |
T |
|
| Q |
188 |
tcctttg |
194 |
Q |
| |
|
||||||| |
|
|
| T |
35277512 |
tcctttg |
35277506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University