View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9656_low_22 (Length: 403)
Name: NF9656_low_22
Description: NF9656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9656_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 3e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 18 - 155
Target Start/End: Original strand, 35985939 - 35986076
Alignment:
| Q |
18 |
gatataaactagtggtttgacaactctaagttttcatttcccttttgacataattaaaatggtttgttgcacttgaatgatcaatttaacatatgtttgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| | |
|
|
| T |
35985939 |
gatataaactagtggtttgacaactctaagttttcatttcccttttcacataattaaaatggtttgttgcacttgaatgatcaatttagcatatgtttcg |
35986038 |
T |
 |
| Q |
118 |
tatcacagatagtatatcagaattacagtgtattatga |
155 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||| |||||| |
|
|
| T |
35986039 |
tatcacagagagtatatcagaatcacattgtgttatga |
35986076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University