View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9656_low_23 (Length: 385)
Name: NF9656_low_23
Description: NF9656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9656_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 17 - 377
Target Start/End: Original strand, 35073825 - 35074164
Alignment:
| Q |
17 |
agtatatagttgcatgcagacataatatgttgtgccatttataaattgttaaaagaaactgacctagctggtcaacgacggtccaaaattaatctcccat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35073825 |
agtatatagttgcatgcagacataatatgttgtgccatttataaattgttaaaagaaactgacctagctggtcaacgacggtccaaaattaatctcccat |
35073924 |
T |
 |
| Q |
117 |
atccccatagatgcggcttcggttctccctaaagccgctaaaaatcccacttggtgggcaacactcctcaggatttaggtggtagttactccggcaccac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35073925 |
atccccatagatgcggcttcggttctccctaaagccactaaaaatcccactta---------------------ttaggtggtagttactccggcaccac |
35074003 |
T |
 |
| Q |
217 |
taatttttgttgcataatttgtcttcccaatttgttctgctgtggcttggtgcattgatttattttttgttgaaattcctgaattttgaatggtattgta |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35074004 |
taatttttgttgcataatttgtcttcccaatttgttctgctgtggcttggtgcattgacttattttttgttgaaattcctgaattttgaatggtattgta |
35074103 |
T |
 |
| Q |
317 |
ttgaatcaaccagctataaaattcaaagtgtaaaatgtggtaaatgttgttcacctttgct |
377 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35074104 |
ttgaatcaaccagctataaaattcacagtgtaaaatgtggtaaatgttgttcacctttgct |
35074164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University