View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9656_low_29 (Length: 366)
Name: NF9656_low_29
Description: NF9656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9656_low_29 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 19 - 366
Target Start/End: Complemental strand, 16708763 - 16708416
Alignment:
| Q |
19 |
gtttggtgggttttcggagtatgaggacaggatttccgagatggagggtttgttgaagaagacggcgaagatgatgcaggtgcaggttgatgttgtggat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16708763 |
gtttggtgggttttcggagtatgaggacaggatttccgagatggagggtttgttgaagaagacggcgaagatgatgcaggtgcaggttgatgttgtggat |
16708664 |
T |
|
| Q |
119 |
aagaagattgggaatgaggttggtgggttaaagaaagaaatggatgcgaaaattgagcaaaaaggcgcgttcttggagaatgagataaagaaattggcga |
218 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16708663 |
aagaagattgggaatgaggttggggggttaaagaaagaaatggatgcgaaaattgagcaaaaaggcgcgttcttggagaatgagataaagaaattggcga |
16708564 |
T |
|
| Q |
219 |
ataagggggataaattggagaggtatttggaggaattgaaggtggaggatttgttaacaaaggaggagtttgagaaatttgtcgagggtttgaagaatgt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16708563 |
ataagggggataaattggagaggtatttggaggaattgaaggtggaggatttgttaacgaaggaggagtttgagaaatttgtcgagggtttgaagaatgt |
16708464 |
T |
|
| Q |
319 |
gaaggggaatgggtatgagggcggtggtttggatgagataagggagtt |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16708463 |
gaaggggaatgggtatgagggcggtggtttggatgagataagggagtt |
16708416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University