View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9656_low_32 (Length: 363)
Name: NF9656_low_32
Description: NF9656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9656_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 10 - 347
Target Start/End: Complemental strand, 20178786 - 20178450
Alignment:
| Q |
10 |
agtttggtgttcttgaacatgaattgtttggttgttggaagtggtttttgaggaagattgagaatcttgttgtgtgatggaagagaaagagagattcaaa |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20178786 |
agttttgtgttcttgaacatgaattgtttggttgttggaagtggtttttgaggaagattgagaatcttgttgtgtgatggaagagaaagagagattcaaa |
20178687 |
T |
 |
| Q |
110 |
tcaataggaagaatgggagaaggtggagttgaggaaatgatgtgaaggattttgaagaagtacatttgggatttggaatagctacgatggctataagaag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
20178686 |
tcaataggaagaatgggagaaggtggagttgaggaaatgatgtgaaggattttgaagaagtacatttgggatttggaatagctacgatggttataagaag |
20178587 |
T |
 |
| Q |
210 |
aagccattgatgttggttgaagaaggggattttttgttttcagagaagaaaagaaaagggttatttcgtcatggtggtatggaccacgattttcaaagca |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20178586 |
aagccattgatgttggttgaagaaggggattttttgttttcagagaagaaaagaaaagggttatttcgtcatggtggtatggaccacgattttcaaagca |
20178487 |
T |
 |
| Q |
310 |
aaaacaacggtgagtgagagaaaacaagtagtaataaa |
347 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20178486 |
aaaacaacggtgagtgagag-aaacaagtagtaataaa |
20178450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University