View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9656_low_45 (Length: 314)
Name: NF9656_low_45
Description: NF9656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9656_low_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 47; Significance: 8e-18; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 239 - 296
Target Start/End: Complemental strand, 8179735 - 8179675
Alignment:
| Q |
239 |
atggagtgcaagttc---atttccttgctggctgaatcttgacgagttgtagaccaagttt |
296 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8179735 |
atggagtgcaagttcttcatttccttgctggctgaatcttgacgagttgtagaccaagttt |
8179675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 126 - 165
Target Start/End: Complemental strand, 8195527 - 8195488
Alignment:
| Q |
126 |
aaaattgatttacggaaaagttcattctcataacgtttta |
165 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8195527 |
aaaattgatttaaggaaaagttcattctcataacgtttta |
8195488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 56 - 98
Target Start/End: Complemental strand, 8195621 - 8195579
Alignment:
| Q |
56 |
ataaatgaatttcatcaaatgtatgtgctacctgattgttttt |
98 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
8195621 |
ataaatgaatttcaacaaatgtatgtgctacctaattgttttt |
8195579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 16 - 54
Target Start/End: Complemental strand, 8195725 - 8195687
Alignment:
| Q |
16 |
ataggatggaaaaagtaatagtcaaaaaataaatcattt |
54 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8195725 |
atagggtggaaaaagtaatagtcaaaaaataaatcattt |
8195687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University