View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9656_low_46 (Length: 309)
Name: NF9656_low_46
Description: NF9656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9656_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 9 - 108
Target Start/End: Complemental strand, 39910180 - 39910082
Alignment:
| Q |
9 |
tggtggtgaagaatgcattataaggtacgtataaaagggtacggcctcgtgtttttgtgaaataaatactagtataggagagtatttattcgtaatggtc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
39910180 |
tggtggtgaagaatgcattataaggtacgtataaaagggtacggcctcgtgtttttgtgaaataaatactagtataggagagtattt-ttcgtagtggtc |
39910082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 192 - 267
Target Start/End: Complemental strand, 39909999 - 39909924
Alignment:
| Q |
192 |
tctattttagtgatctaaattagacacatcattatctcgtaaagtatttgttagtgaaaatcaatatcactccctt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
39909999 |
tctattttagtgatctaaattagacacatcattctctcgtaaaataattgttagtgaaaatcaatatcactccctt |
39909924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University