View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9656_low_71 (Length: 253)
Name: NF9656_low_71
Description: NF9656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9656_low_71 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 253
Target Start/End: Complemental strand, 14222115 - 14221880
Alignment:
| Q |
18 |
attttcatctgtgccattaggtggtatcccagaagagggtaccaatgcaacctgtctagtatcaaccatatccttgaacaaagtagttaattcaatgtaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14222115 |
attttcatctgtgccattaggtggtatcccagaagagggtaccaatgcaacctgtctagtatcaaccatatccttgaacaaagtagttaattcaatgtaa |
14222016 |
T |
|
| Q |
118 |
aatggaagtcccttttgcctaaactttccatactgtggattttcctgcgtgtttataaactaatcaacacaatatactacacacaaaagttcacaaaaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14222015 |
aatggaagtcccttttgcctaaactttccatactgtggattttcctgcgtgtttataaactaatcaacacaatatactacacacaaaagttcacaaaaag |
14221916 |
T |
|
| Q |
218 |
acaacttaacatttaaaacttcataccagttgtttt |
253 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14221915 |
acaacttaatatttaaaacttcataccagttgtttt |
14221880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University