View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9656_low_83 (Length: 240)
Name: NF9656_low_83
Description: NF9656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9656_low_83 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 37384561 - 37384339
Alignment:
| Q |
1 |
gacaattacaaaagcattgtacataataagtctaggaacaaacgactttctagagaattattatacaattcctggcagggcatctcaatacacacctagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37384561 |
gacaattacaaaagcattgtacataataagtctaggaacaaacgactttctagagaattattatacaattcctggcagggcatctcaatacacacctagt |
37384462 |
T |
|
| Q |
101 |
gagtatcaaaattttcttgctggaatagctcaaaatttcatccacaaactttatgatcttggtgctaagaaaatatccctaggaggtttacctccaatgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37384461 |
gagtatcaaaattttcttgctggaatagctcaaaatttcatccacaaactttatgatcttggtgctaagaaaatatccctaggaggtttacctccaatgg |
37384362 |
T |
|
| Q |
201 |
gatgcttgcctttggagagaact |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37384361 |
gatgcttgcctttggagagaact |
37384339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 35 - 223
Target Start/End: Original strand, 36600506 - 36600694
Alignment:
| Q |
35 |
ggaacaaacgactttctagagaattattatacaattcctggcagggcatctcaatacacacctagtgagtatcaaaattttcttgctggaatagctcaaa |
134 |
Q |
| |
|
||||||||||| || ||||||||||| ||||| || || || |||||||| |||||||||||| |||| |||| ||||||||||||||||||| | | |
|
|
| T |
36600506 |
ggaacaaacgatttcctagagaattactataccatgccaggaagggcatcacaatacacacctcaacagtaccaaacttttcttgctggaatagctgaga |
36600605 |
T |
|
| Q |
135 |
atttcatccacaaactttatgatcttggtgctaagaaaatatccctaggaggtttacctccaatgggatgcttgcctttggagagaact |
223 |
Q |
| |
|
||||||| || || |||| ||||||||||| ||| || || |||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36600606 |
atttcataaggaatctatatgctcttggtgctaggaagatttctctaggagggttacctccaatgggatgcttgccattggagagaact |
36600694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University