View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9656_low_89 (Length: 231)
Name: NF9656_low_89
Description: NF9656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9656_low_89 |
 | |
|
| [»] scaffold0365 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0365 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: scaffold0365
Description:
Target: scaffold0365; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 17 - 193
Target Start/End: Complemental strand, 2297 - 2121
Alignment:
| Q |
17 |
cataggaattggagtatgctgagtggaataggccacaaagagacacggagtatggagatttccaaagatggagaatgcggaaaatatcaataaggtgttc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2297 |
cataggaattggagtatgctgagtggaataggccacaaagagacacggagtatggagatttccaaagatggagaatgcggaaaatatcaataaggtgttc |
2198 |
T |
|
| Q |
117 |
aaggaaagttccatgtttgtgccaacattcggatgcaccaaccgaacggaggattgtgattagggaagggaggttgg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
2197 |
aaggaaagttccatgtttgtgccaacattcagatgcaccaacagaacggaggattgtgattagggaagggagtttgg |
2121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0365; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 143 - 193
Target Start/End: Complemental strand, 17341 - 17291
Alignment:
| Q |
143 |
attcggatgcaccaaccgaacggaggattgtgattagggaagggaggttgg |
193 |
Q |
| |
|
||||||||||||| || |||||||||| ||||||| ||||||||||||||| |
|
|
| T |
17341 |
attcggatgcacctacggaacggaggactgtgattcgggaagggaggttgg |
17291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 143 - 193
Target Start/End: Original strand, 14492743 - 14492793
Alignment:
| Q |
143 |
attcggatgcaccaaccgaacggaggattgtgattagggaagggaggttgg |
193 |
Q |
| |
|
||||||||||||| || |||||||||| ||||||| ||||||||||||||| |
|
|
| T |
14492743 |
attcggatgcacctacggaacggaggactgtgattcgggaagggaggttgg |
14492793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University