View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9656_low_92 (Length: 226)
Name: NF9656_low_92
Description: NF9656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9656_low_92 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 16 - 208
Target Start/End: Complemental strand, 8343011 - 8342819
Alignment:
| Q |
16 |
tttcgtgttctacacaaaagaacaggacacaatttcaagaacttttccttgtgtaccatgtcctgatattaatatacaaaaatatggaaataaatagtag |
115 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8343011 |
tttcttgttctacacaaaagaacaagacacaatttcaagaacttttccttgtttaccatgtcctgatattaatatacaaaaatatggaaataaatagtag |
8342912 |
T |
 |
| Q |
116 |
ttgtcaaaatacaagagagttttgaacctgatgaaatgcaaaatacatattatacgttttgctcccatatcctctttgtagtaaagccaaatc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8342911 |
ttgtcaaaatacaagagagttttgaacctgatgaaatgcaaaatacatattatacgttttgctcccatatcctctttgtagtaaagccaaatc |
8342819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University