View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9657_high_5 (Length: 287)
Name: NF9657_high_5
Description: NF9657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9657_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 49 - 280
Target Start/End: Complemental strand, 43702900 - 43702669
Alignment:
| Q |
49 |
acttattacaataaccaataatcagttacaccgaaatttcaatttcataaactaatatcgaagaaacgcaacattcnnnnnnnnnnnnnnnnncctgtta |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
43702900 |
acttattacaataaccaataatcagttacaccgtaatttcaatttcataaactaatattgaagaaacgcaacattcagagagagaaagagagacctgtta |
43702801 |
T |
|
| Q |
149 |
tggatgcggactttgaaccgggtttagcgtggatggttatagcgacggatgaaggaggcatgcagcgaatacaagacggaatattgttaggtttttccga |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43702800 |
tggatgcggactttgaaccgggtttagcgtggatggttatagcgacggatgaaggaggcatgcagcgaatacaagacggaatattgttaggtttttccga |
43702701 |
T |
|
| Q |
249 |
aggaaccgtttcctttggttctgcctttgctt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43702700 |
aggaaccgtttcctttggttctgcctttgctt |
43702669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University