View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9657_high_7 (Length: 250)
Name: NF9657_high_7
Description: NF9657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9657_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 7370227 - 7369991
Alignment:
| Q |
1 |
ttttggccccattctgaagacaatttactatctgataggattgtttttgaccccaaataaaaatgattacacacacataaaaatgcatatcactcaagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7370227 |
ttttggccccattctgaagacaatttactatctgatagaattgtttttgaccccaaataaaaatgattacacacacataaaaatgcatatcactcaagtg |
7370128 |
T |
 |
| Q |
101 |
tgtgtccaaatcatatttttatttgatgttgtgatctaataaatgtttcacttgaaaacattattataaacatgttaaatgattnnnnnnnnnttagttt |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| | ||||||||||||||||| |||| ||||||| |
|
|
| T |
7370127 |
tttgtccaaatcatatttttatttgatgttg-gatctaataaatgttgcacttgaaaaaaaaattataaacatgttaaa-gatt-aaaaaaaattagttt |
7370031 |
T |
 |
| Q |
201 |
ggaaaatatgtgcagctgtgtagaatttcaatcatctctg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7370030 |
ggaaaatatgtgcagctgtgtagaatttcaatcatctctg |
7369991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University