View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9657_low_6 (Length: 422)
Name: NF9657_low_6
Description: NF9657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9657_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 8 - 406
Target Start/End: Complemental strand, 7132446 - 7132048
Alignment:
| Q |
8 |
aatgaatctcctaatttcttcttacatgtcnnnnnnnnaccaaatgcccagagccacgcttatttcttgatattaataatctaatgtcaccacgtatttt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7132446 |
aatgaatctcctaatttcttcttacatgtcttttttttaccaaatgcccagagccacacttatttcttgatattaataatctaatgtcaccacatatttt |
7132347 |
T |
 |
| Q |
108 |
tgtactgaatgcacaaaaccacacttttgcttgatattaatagttcattataattgacaggtgatgggaaatgcaaatgctctgatacaatccgaagatt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7132346 |
tgtactgaatgcacaaaaccacacttttgcttgatattaatagttcattataattgacaggtgatgggaaatgcaaatgctctgatacaatccgaagatt |
7132247 |
T |
 |
| Q |
208 |
gggctgcattgattgcagatgcaagatcccgaaattgctacatggacatggattctattcccaaggactttctggcgaccaagggacctgtttacacacc |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7132246 |
gggctgcattgattgcagatgcaagatcccgaaattgctacatggacatggattctattcccaaggactttctggtgaccaagggacctgtttacacacc |
7132147 |
T |
 |
| Q |
308 |
attgcccggtaagccaccctcaaatatgaggggaatgagatcaggcgggccaagatataatagatcaatggagatgcatacggaatccagggtgggagc |
406 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7132146 |
attgcccggtaaaccaccctcaaatatgaggggaataagatcaggcgggccaagatataatagatcaatggagatgcatacggaatccagggtgggagc |
7132048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University