View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9659_low_10 (Length: 388)
Name: NF9659_low_10
Description: NF9659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9659_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 30 - 375
Target Start/End: Complemental strand, 40709167 - 40708814
Alignment:
| Q |
30 |
tttttgatcacttcctcccctgccatagtttccatgcgtcctttatatatcttgcaagtggctaaatgcttaatcaatttctttattaccgttgccacat |
129 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40709167 |
tttttgatcacttcctccccggccatagtttccatgcgtcctttatatatcttgcaagtggctaaatgcttaatcaatttcttcattaccgttgccacat |
40709068 |
T |
 |
| Q |
130 |
tttcatagaaaatcaatgatattaatggccatgaaagcctaagaacaacggttagataaactctataacggtaagcatttaaaccaattgagtaaaggac |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40709067 |
tttcatagaaaatcaatgatattaatggccatgaaagcctaagaacaacggttagataaactctataacggtaagcatttaaaccaattgagtaaaggac |
40708968 |
T |
 |
| Q |
230 |
acttgattgattgtgcaacacatgcttgcttatgatcaataatcatgttcatcaaccaaagcaacatttgattattgatactcactgagtttttctattg |
329 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40708967 |
acttg----attgtgcaacacatgcttgcttatgatcaataatcatgttcatcaaccaaagcaacatttgattattgatactcactgagtttttctattg |
40708872 |
T |
 |
| Q |
330 |
tc------------aacaactcagcactcccttactctttatcctccatgttctcttt |
375 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40708871 |
tccttcctccgcttaacaactcagcactcccttactctttatcctccatgttctcttt |
40708814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University