View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9659_low_20 (Length: 232)
Name: NF9659_low_20
Description: NF9659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9659_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 37 - 215
Target Start/End: Original strand, 672299 - 672477
Alignment:
| Q |
37 |
tttggtggtcggatacaagacactgcttcaatttaatgtgtcagtgctactgcattggcaaagatcgtgcctttaggctcgcataatacattgtttgctt |
136 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
672299 |
tttgatggttggatacaagacactgcttcaatttaatgtgtcagtgctactgcattggcaaagatcgtgcctttaggctcgcataatacattgtttgctt |
672398 |
T |
|
| Q |
137 |
ttagttatctcttgcatgttttttcatatagttgagaactgcattgtcgtcgaatttttgcctcaacacatgtgctccc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
672399 |
ttagttatctcttgcatgttttttcatatagttgagaactgcattgtcgtcgaatttttgtctcaacacatgtgctccc |
672477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 37 - 215
Target Start/End: Complemental strand, 21265706 - 21265528
Alignment:
| Q |
37 |
tttggtggtcggatacaagacactgcttcaatttaatgtgtcagtgctactgcattggcaaagatcgtgcctttaggctcgcataatacattgtttgctt |
136 |
Q |
| |
|
|||| |||| ||| ||||||||||||||||||||||||||| || |||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21265706 |
tttgatggttggacacaagacactgcttcaatttaatgtgttagcgctactacattggcaaagatcgtgtctttaggctcgcataatacattgtttgctt |
21265607 |
T |
|
| Q |
137 |
ttagttatctcttgcatgttttttcatatagttgagaactgcattgtcgtcgaatttttgcctcaacacatgtgctccc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
21265606 |
ttagttatctcttgcatgttttttcatatagttgagaactgcattgtcgtcgaatatttgtctcaacacatgtgctccc |
21265528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 37 - 215
Target Start/End: Complemental strand, 18636275 - 18636097
Alignment:
| Q |
37 |
tttggtggtcggatacaagacactgcttcaatttaatgtgtcagtgctactgcattggcaaagatcgtgcctttaggctcgcataatacattgtttgctt |
136 |
Q |
| |
|
|||| |||| ||| ||||||||||||||||||||||||||| || |||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18636275 |
tttgatggttggacacaagacactgcttcaatttaatgtgtaagcgctactacattggcaaagatcgtgactttaggctcgcataatacattgtttgctt |
18636176 |
T |
|
| Q |
137 |
ttagttatctcttgcatgttttttcatatagttgagaactgcattgtcgtcgaatttttgcctcaacacatgtgctccc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |||||| |
|
|
| T |
18636175 |
ttagttatctcttgcatgttttttcatatagttgagaactgcattgtcgtcgaatatttgtctcaacacatgcgctccc |
18636097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University