View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9659_low_21 (Length: 213)
Name: NF9659_low_21
Description: NF9659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9659_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 10 - 197
Target Start/End: Complemental strand, 39258910 - 39258723
Alignment:
| Q |
10 |
gattattctctatagaaagtcagaatgttgttaaaagttttcaatactataatatgaattagtgattagtgatgataataaaaatgaaattaacaaacac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39258910 |
gattattctctatagaaagtcagaatgttgttaaaagttttcaatactataatatgaattagtgattagtgatgataataaaaatgaaattaacaaacac |
39258811 |
T |
|
| Q |
110 |
tatatattatttgttaaatagtataatggaaagcactatcccagttttccagctcggaaaccactcattcgtttccatgtctccatcc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39258810 |
tatatattatttgttaaatagtataatggaaagcactatcccagttttccagctcggaaaccactcattcgtttccatgtatccatcc |
39258723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University