View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9660_low_14 (Length: 351)
Name: NF9660_low_14
Description: NF9660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9660_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 7 - 335
Target Start/End: Complemental strand, 8413876 - 8413548
Alignment:
| Q |
7 |
tttggtgttgaacattacgagttttggcccaccattttcactgctaccacggcctccacttgcacctgaacttgctcttgcaggactctttttcttctcc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8413876 |
tttggtgttgaacattacgagttttggcccaccattttcactgctaccacggcctccacttgcacctgaacttgctcttgcaggactctttttcttctcc |
8413777 |
T |
|
| Q |
107 |
ccagaaaccttttctttgagcttcttgcgccatctccataagccgatgatgtaaaaacaacaaaacagaactaatacgaaagctcctattgcaatgatga |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8413776 |
ccagaaaccttttctttgagcttcttgcgccatctccataagccgatgatgtaaaaacagcaaaacagaactaataagaaagctcctattgcaatgatga |
8413677 |
T |
|
| Q |
207 |
taaccaacacaatcaacctctttttgtccctattgtctgtaccttcacactttgattccaatggcttcccacataaaccctgattatcagcaaatacaga |
306 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8413676 |
tgaccaacacaatcaacctctttttgtccctattgtctgtaccttcacactttgattccaatggcttcccacataaaccctgattatcagcaaataaaga |
8413577 |
T |
|
| Q |
307 |
agggttgttgaaccgtgatcccatagttt |
335 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8413576 |
agggttgttgaaccgtgatcccatagttt |
8413548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University