View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9660_low_16 (Length: 310)
Name: NF9660_low_16
Description: NF9660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9660_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 38 - 299
Target Start/End: Original strand, 3144156 - 3144417
Alignment:
| Q |
38 |
ataaaagcagtatacaatgtatatttgtagttgtatctatgtatgtattgatcgacaaaggcgtcagagggtgggaacgatcatgattaagttggcagag |
137 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3144156 |
ataaaagcagtatagaatgtatatttgtagttgtatacatgtatgtattgatcgacaaaggcgtcagagggtgggaacgatcatgattaagttggcagag |
3144255 |
T |
|
| Q |
138 |
aaagtgtgtttggctcagaatagagaatagaaagaaagaaacagcagagaccacagagtacagacctctctcattcactcttttgagatttgcgccccaa |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3144256 |
aaagtgtgtttggctcagaatagagaatagaaagaaagaaacagcagagaccacagagtacagacctctctcattcactcttttgagatttgcgccccaa |
3144355 |
T |
|
| Q |
238 |
ccataatcttaactcatcttggacttggttttaagcaaataaggcggcgaccattactctct |
299 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3144356 |
ccataatcttaactcatcttggacttagttttaagcaaataaggcggcgaccattactctct |
3144417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University