View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9660_low_25 (Length: 230)
Name: NF9660_low_25
Description: NF9660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9660_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 35445218 - 35445006
Alignment:
| Q |
1 |
ttcgagagaatttttgtttgctagtttaaagtttgcagttgaaaatattaactcgccgttgtctctatattcccttcgaattactttgattttctatttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35445218 |
ttcgagagaatttttgtttgctagtttaaagtttgccgttgaaaatatcaactcgccgttgcctctatattcccttcgaattactttgattttctatttc |
35445119 |
T |
 |
| Q |
101 |
aaaaactttactctctataactaactagagatatgaaacccacttaatcaaaaagctcatttggttaaatttgacaattaattaagctattgaatttcac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
35445118 |
aaaaactttactctctataactaactagagatatgaaacccacttaatcaaaaagctcatttggttaaatttgacaatttattaagttattgaatttcac |
35445019 |
T |
 |
| Q |
201 |
ttagtcagttaat |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35445018 |
ttagtcagttaat |
35445006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University