View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9660_low_28 (Length: 210)
Name: NF9660_low_28
Description: NF9660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9660_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 17 - 200
Target Start/End: Original strand, 5718304 - 5718487
Alignment:
| Q |
17 |
aatacacacaccatttgaacctggtctgaattcaatagttaattagaccccaaatagataacgtgtcaattgttataatatcatattcacgcataatgtg |
116 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5718304 |
aatacacacgccatttgaacctggtctgaattcaatagttaattagaccccaaatagataacgtgtcaattgtcataatatcatattcacgcataatgtg |
5718403 |
T |
|
| Q |
117 |
gaggagaataatgattagatttggataactacaaactgaaaaatggtaagaagaaagaatggaaaatgcagaaacacgaaactc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5718404 |
gaggagaataatgattagatttggataactacaaactgaaaaatggtaagaagaaagaatggaaaatgcagaaacacgaaactc |
5718487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University