View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9661A_low_103 (Length: 259)
Name: NF9661A_low_103
Description: NF9661A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9661A_low_103 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 5 - 110
Target Start/End: Original strand, 20232527 - 20232632
Alignment:
| Q |
5 |
caatgacaaacataaaatatattttgaattcaaacattgagcccttcatttatctctatctcacaagatgattaaaacatactctaaatgagctaggaat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20232527 |
caatgacaaacataaaatatattttgaattcaaacattgagcccttcatttatctctatctcacaagatgattaaaacatactctaaatgagctaggaat |
20232626 |
T |
 |
| Q |
105 |
caaagc |
110 |
Q |
| |
|
|||||| |
|
|
| T |
20232627 |
caaagc |
20232632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 178 - 247
Target Start/End: Original strand, 20232703 - 20232771
Alignment:
| Q |
178 |
gatgatgttacaaataatatnnnnnnntactgacttacgaatcaatgcttgaaaataggacagctatatt |
247 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20232703 |
gatgatgttacaaataatataaaaaa-tactgacttacgaatcaatgcttgaaaataggacagctatatt |
20232771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University