View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9661A_low_113 (Length: 250)
Name: NF9661A_low_113
Description: NF9661A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9661A_low_113 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 76; Significance: 3e-35; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 157 - 248
Target Start/End: Complemental strand, 11555891 - 11555800
Alignment:
| Q |
157 |
caagtgactgtaaattatggtactatcataacttactaaccttttcatttcccaagcatcctttcgatatgtgatgtccatctcattgttct |
248 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
11555891 |
caagtgactgtaaattatagtactatcataacttactaaccttttcatttcccaagcatcctttcgatatgtgatgtaaatttcattgttct |
11555800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 15 - 73
Target Start/End: Complemental strand, 11530519 - 11530461
Alignment:
| Q |
15 |
aatgttccggaatttatcgaaaagcctagctgcgtctatggtgttttatttctgtctga |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11530519 |
aatgttccggaatttatcgaaaagcctagctgcgtctatggtgttttatttctgtctga |
11530461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 15 - 73
Target Start/End: Complemental strand, 11556016 - 11555958
Alignment:
| Q |
15 |
aatgttccggaatttatcgaaaagcctagctgcgtctatggtgttttatttctgtctga |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11556016 |
aatgttccggaatttatcgaaaagcctagctgcgtctatggtgttttatttctgtctga |
11555958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 189 - 248
Target Start/End: Complemental strand, 11530213 - 11530154
Alignment:
| Q |
189 |
ttactaaccttttcatttcccaagcatcctttcgatatgtgatgtccatctcattgttct |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
11530213 |
ttactaaccttttcatttcccaagcatcctttcgatatgtgatgtaaatttcattgttct |
11530154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University