View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9661A_low_117 (Length: 250)
Name: NF9661A_low_117
Description: NF9661A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9661A_low_117 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 8 - 247
Target Start/End: Original strand, 38708858 - 38709097
Alignment:
| Q |
8 |
atcaaattatggacgatagcaaattgaaggattttaaagccaagaattgtctattttaatctatagatcaaaatattcttaaaacgattcttaaccaaga |
107 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38708858 |
atcaaattatggacgagaacaaattgaaggattttaaagccaagaattgtctattttaatctatagatcaaaacattcttaaaacgattcttaaccaaga |
38708957 |
T |
|
| Q |
108 |
aacatcgaaggatatatgggattccataaaatagaagcatgagggatgaaagatgaagagacggttgatcgatctgttttcactttgcaccgttggtgaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
38708958 |
aacatcgaaggatatatgggattccataaaacagaagcatgagggatgaaagatgaagagacggttgatcgatctgttttctctccgcaccgttggtgaa |
38709057 |
T |
|
| Q |
208 |
ggagtgagcttccaacgtcgtcgagagggtgatttgttct |
247 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
38709058 |
ggagtgagcttccaacgtcttcgagagggtgttttgttct |
38709097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University