View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9661A_low_138 (Length: 243)
Name: NF9661A_low_138
Description: NF9661A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9661A_low_138 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 23 - 222
Target Start/End: Complemental strand, 3675535 - 3675336
Alignment:
| Q |
23 |
atatgatgggtttttgtcaaaatttaatttgtatggaactttaattaataannnnnnnaatcttaggtatttgcttgtggtagcattttttacaagtata |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3675535 |
atatgatgggtttttgtcaaaatttaatttgtatggaactttaattaataatttttttaatcttaggtatttgcttgtggtagcattttttacaagtata |
3675436 |
T |
|
| Q |
123 |
tacacaggaagccaagtgtatcgtcaaattcatgaacttatcactgggaataatatatttcgacctacaactgcagctgtgattgatattattggagatc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||| |
|
|
| T |
3675435 |
tacacaggaagccaagtgtatcgtcaaattcatgaacttatcactgggaataatatatttcgacctacaactgcagctgtgattgattttgttggggatc |
3675336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University