View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9661A_low_139 (Length: 243)
Name: NF9661A_low_139
Description: NF9661A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9661A_low_139 |
 |  |
|
| [»] scaffold0149 (1 HSPs) |
 |  |  |
|
| [»] scaffold2125 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 21 - 220
Target Start/End: Complemental strand, 2506911 - 2506712
Alignment:
| Q |
21 |
acttcgcacataatataatattccattttagttacactttttattctctttctatattacagggggttatctatgtgttactgattctgattgtccacca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2506911 |
acttcgcacataatataatattccattttagttacactttttattctctttctatatttcagggggttatctatgtgttactgattctcattgtccacca |
2506812 |
T |
 |
| Q |
121 |
catatgtgccccccgggtatggaaccgaggtgtgtgcgtcgaatgtgtaaatgccttccgatagggtggagaaaatactttgtgccatgaattttcattt |
220 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2506811 |
catatgtgcccccccggtatggaaccgaggtgtgtgcgtcgaatgtgtaaatgccttccgatagggtggagaaaatactttgtgccatgaattttcattt |
2506712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 32 - 69
Target Start/End: Complemental strand, 3400779 - 3400742
Alignment:
| Q |
32 |
aatataatattccattttagttacactttttattctct |
69 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
3400779 |
aatatattatcccattttagttacactttttattctct |
3400742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0149 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: scaffold0149
Description:
Target: scaffold0149; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 28 - 159
Target Start/End: Original strand, 25774 - 25906
Alignment:
| Q |
28 |
acataatataatattccattttagttacactttttattctctttctatatt-acagggggttatctatgtgttactgattctgattgtccaccacatatg |
126 |
Q |
| |
|
|||||||||| ||| |||||||||||||| ||||||||| ||| | | || ||||| ||||||| |||| |||||||||||||||||||||| ||||| |
|
|
| T |
25774 |
acataatatattatctcattttagttacacattttattctttttttttttttacaggaggttatcgatgtactactgattctgattgtccaccaaatatg |
25873 |
T |
 |
| Q |
127 |
tgccccccgggtatggaaccgaggtgtgtgcgt |
159 |
Q |
| |
|
|||||||| || |||||||| | |||||||||| |
|
|
| T |
25874 |
tgcccccctggaatggaaccaaagtgtgtgcgt |
25906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 21 - 153
Target Start/End: Complemental strand, 22931495 - 22931361
Alignment:
| Q |
21 |
acttcgcacataatataatattccattttagttacactttttattctct--ttctatattacagggggttatctatgtgttactgattctgattgtccac |
118 |
Q |
| |
|
||||| |||| |||||| ||| ||||||||||||||||||||||||||| || | | | ||| || ||||| |||| |||||||||||||||||||| |
|
|
| T |
22931495 |
acttcccacacaatatattatcccattttagttacactttttattctctctttttttgtgacaaggtattatccatgtaatactgattctgattgtccac |
22931396 |
T |
 |
| Q |
119 |
cacatatgtgccccccgggtatggaaccgaggtgt |
153 |
Q |
| |
|
| |||||||| |||| | |||||||||||||||| |
|
|
| T |
22931395 |
aaaatatgtgcacccctgatatggaaccgaggtgt |
22931361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 28 - 159
Target Start/End: Original strand, 24061239 - 24061375
Alignment:
| Q |
28 |
acataatataatattccattttagttacactttttattctc--tttcta---tattacagggggttatctatgtgttactgattctgattgtccaccaca |
122 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||||| ||| || ||||||||| ||| ||| |||| |||||||||| |||||||||| | |
|
|
| T |
24061239 |
acataatatattatcccattttagttacactttttattctcattttttattttattacaggaggtcatcgatgttctactgattctttttgtccaccaaa |
24061338 |
T |
 |
| Q |
123 |
tatgtgccccccgggtatggaaccgaggtgtgtgcgt |
159 |
Q |
| |
|
||||||||| || |||||| ||| | |||||||||| |
|
|
| T |
24061339 |
tatgtgccctcctggtatgacaccaaagtgtgtgcgt |
24061375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold2125 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold2125
Description:
Target: scaffold2125; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 32 - 71
Target Start/End: Original strand, 438 - 477
Alignment:
| Q |
32 |
aatataatattccattttagttacactttttattctcttt |
71 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
438 |
aatatattattccattttagttacattttttattctcttt |
477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University