View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9661A_low_145 (Length: 242)

Name: NF9661A_low_145
Description: NF9661A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9661A_low_145
NF9661A_low_145
[»] chr3 (1 HSPs)
chr3 (21-226)||(28250104-28250309)
[»] chr5 (1 HSPs)
chr5 (69-182)||(32179733-32179846)


Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 21 - 226
Target Start/End: Original strand, 28250104 - 28250309
Alignment:
21 gacatcacgaggaggtcgtcgacggtaacgtgttcgaggattgccgagattcgtttctcgagttcggttttgcagacggtggaggcgcggaggtggatgg 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28250104 gacatcacgaggaggtcgtcgacggtaacgtgttcgaggattgccgagattcgtttctcgagttcggttttgcagacggtggaggcgcggaggtggatgg 28250203  T
121 cgcaacggaggaggcagcaaaggaagttgattggaaaagctgctttctctgaagggaagagattgataattaactgtagaaggcttcgttgttttgatct 220  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||    
28250204 cgcaacggaggaggcagcaaaggaagttgattggaaaagctgctttctccgaagggaagagattgataattaactctagaaggcttcgttgttttgatct 28250303  T
221 gatgtc 226  Q
    ||||||    
28250304 gatgtc 28250309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 69 - 182
Target Start/End: Original strand, 32179733 - 32179846
Alignment:
69 attcgtttctcgagttcggttttgcagacggtggaggcgcggaggtggatggcgcaacggaggaggcagcaaaggaagttgattggaaaagctgctttct 168  Q
    ||||| ||||||||||||   |||||  || | |||||||| |||| ||| || |||||||| || ||||| ||||||||||| |||||||| |||||||    
32179733 attcgcttctcgagttcgcgcttgcacgcgcttgaggcgcgtaggtagatagcacaacggagaagacagcagaggaagttgatcggaaaagcagctttct 32179832  T
169 ctgaagggaagaga 182  Q
    | || || ||||||    
32179833 ccgacggaaagaga 32179846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University