View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9661A_low_177 (Length: 230)
Name: NF9661A_low_177
Description: NF9661A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9661A_low_177 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 36268913 - 36268687
Alignment:
| Q |
1 |
gactgcttgataatatttgtcggaaggttggggatgagtcttctactctgttttggaatgatccttggttggatggtagatctttgaaagatagttttag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36268913 |
gactgcttgataatatttgtcggaaggttggtgatgagtcttctactttgttttgaaatgatccttggttggatcgtagatctttgaaagatagttttag |
36268814 |
T |
 |
| Q |
101 |
aagtttgtttgagttagctgataacaaattggcaacagtcgcggagatgttttctttgggttggggagtgaatgacgaggcct-gaagtagcgtatgagg |
199 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
36268813 |
aagtttgtttcagttagctgataacaaattggcaacggtcgcggaaatgttttctttgggttggggagtgaatgacgaggcttaaaagtagcgtatgagg |
36268714 |
T |
 |
| Q |
200 |
ttgcttgaaagtagcagtcaataatca |
226 |
Q |
| |
|
|||||||||||||||| |||||||||| |
|
|
| T |
36268713 |
ttgcttgaaagtagcaatcaataatca |
36268687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University