View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9661A_low_182 (Length: 230)
Name: NF9661A_low_182
Description: NF9661A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9661A_low_182 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 26344828 - 26345057
Alignment:
| Q |
1 |
ggatgcgtgtttagaaaaatgattatgattgatttttgcaaaaaatgtttcgagcctttggaccaagattatgtgatttgtgtttaaatgtttttcttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26344828 |
ggatgcgtgtttagaaaaatgattatgattgatttttgcaaaaattgtttcgagcctttggaccaagattatgtgatttgtgtgtaaatgtttttcttaa |
26344927 |
T |
 |
| Q |
101 |
taacgatggttgtacaaaacttaatacaaaactaacaacttgcttaagatttattctaccaatgcaattttggtttatagtaagtttgnnnnnnngtaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26344928 |
taacgatggttgtacaaaacttaatacaaaactaacaacttgctcaagatttattctaccaatgcaattttggtttatagtaagtttgtttttttgtaat |
26345027 |
T |
 |
| Q |
201 |
caagtttactgccaccaaactcacatttga |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26345028 |
caagtttactgccaccaaactcacatttga |
26345057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University