View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9661A_low_189 (Length: 229)

Name: NF9661A_low_189
Description: NF9661A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9661A_low_189
NF9661A_low_189
[»] chr5 (1 HSPs)
chr5 (1-207)||(32472865-32473071)


Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 32472865 - 32473071
Alignment:
1 gttgttaaggatagcgccgttggagggaacggcgaagtggtgttcatacatggcggggatgttgggagcgatgacggagacgacgttgccgcggcggata 100  Q
    ||||||||||||||| ||| || |||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32472865 gttgttaaggatagctccggtgaaggggacggcgaagtggagttcatacatggcggggatgttgggagcgatgacggagacgacgttgccgcggcggata 32472964  T
101 cctaaggaggtgatggcggaggcaagttggaggcatcgtttgtgggtttgagaccatgtgaaaacggtgtcgttgtagatgatggaaggtgtgttggggt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32472965 cctaaggaggtgatggcggaggcaagttggaggcatcgtttgtgggtttgagaccatgtgaaaacggtgtcgttgtagatgatggaaggtgtgttggggt 32473064  T
201 agattgt 207  Q
    |||||||    
32473065 agattgt 32473071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University