View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9661A_low_196 (Length: 227)
Name: NF9661A_low_196
Description: NF9661A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9661A_low_196 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 61 - 221
Target Start/End: Original strand, 33399827 - 33399989
Alignment:
| Q |
61 |
aggacagctgattccttccttttgaggtgctataaattgtccaaattcctatttcctctagtcacccgaatgacatttctcatgcggggagctaacaaga |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399827 |
aggacagctgattccttccttttgaggtgctataacttgtccaaattcctatttcctctagtcacccgaatgacatttctcatgcggggagctaacaaat |
33399926 |
T |
|
| Q |
161 |
gtggcttcttttcgttgtagtcttcacataaatttttgaaga--atagaaatgaatctcttca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |||| |
|
|
| T |
33399927 |
gtggcttcttttcgttgtagtcttcacataaattcttgaagatcatagaaatgaatcttttca |
33399989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 36 - 104
Target Start/End: Complemental strand, 32492895 - 32492827
Alignment:
| Q |
36 |
tggacacaatgctcccccttcccttaggacagctgattccttccttttgaggtgctataaattgtccaa |
104 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32492895 |
tggacgcaatgcccccccttcccttaggacagctgattccttccttttgaggtgctataaattgtccaa |
32492827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 221
Target Start/End: Complemental strand, 32492828 - 32492759
Alignment:
| Q |
154 |
aacaagagtggcttcttttcgttgtagtcttcac--ataaatttttgaagaatagaaatgaatctcttca |
221 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
32492828 |
aacaagagtggcttcttttcgttgcagtcttcacatataaattcttgaagaatagaaatgaatctcttca |
32492759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University