View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9661A_low_198 (Length: 226)

Name: NF9661A_low_198
Description: NF9661A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9661A_low_198
NF9661A_low_198
[»] chr8 (1 HSPs)
chr8 (134-204)||(12024721-12024791)


Alignment Details
Target: chr8 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 134 - 204
Target Start/End: Original strand, 12024721 - 12024791
Alignment:
134 aagaaacatattagtcaaaacagtaatttacactataattaaactgattcaacggtcgcttatattcttcg 204  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
12024721 aagaaacatattggtcaaaacagtaatttacactataattaaactgattcaacggtctcttatattcttcg 12024791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University