View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9661A_low_207 (Length: 223)
Name: NF9661A_low_207
Description: NF9661A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9661A_low_207 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 22 - 104
Target Start/End: Complemental strand, 29294683 - 29294601
Alignment:
| Q |
22 |
atttgtttgggaagagtttttattgaagtcaaatttgaattttttctgttgtttctctctcggttggttggtatgatgattca |
104 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29294683 |
atttgtttgcgaagagtttttattgaagtcaaatttgaattttttatgttgtttctctctcggttggttggtgcgatgattca |
29294601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 29294529 - 29294501
Alignment:
| Q |
176 |
ctattggttcttatgtttgattgcttctt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29294529 |
ctattggttcttatgtttgattgcttctt |
29294501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University