View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9661A_low_219 (Length: 214)
Name: NF9661A_low_219
Description: NF9661A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9661A_low_219 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 40688229 - 40688442
Alignment:
| Q |
1 |
ataatatcgatgtggaattacatgcaattttgctcatagtttggttttgatcacttgggatattggagtaacggttttaaggaagccatttgtgaaccta |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40688229 |
ataatatcgatgttgaattacatgcaattttgctcatagtttggttctgatcacttgggatattggagtaacggttttaaggaagccatttgtgaatcta |
40688328 |
T |
|
| Q |
101 |
actgcaagactatctccaatctgatagaatctgagtgtaaggaataatcctatacacattcatccttatgctcccatcattcaatatgttagatccttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40688329 |
actgcaagactatctccaatctgatagaatctgagtgtaaggaataatcctatatacactcatccttatgctcccatcattcaatatgttagatccttta |
40688428 |
T |
|
| Q |
201 |
tgaatgcctctaat |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
40688429 |
tgaatgcctctaat |
40688442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University