View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9661A_low_220 (Length: 213)
Name: NF9661A_low_220
Description: NF9661A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9661A_low_220 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 46 - 212
Target Start/End: Complemental strand, 33034938 - 33034771
Alignment:
| Q |
46 |
gttttggga-attttcaagctaagcctttttccaatttactttgtttgtgctaccgctgcatctgtcaactctcttagggatttgttccttgaattatgg |
144 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||| || ||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33034938 |
gttttgggatattttcaagctaagcctttttccaatctactttgtctgcgctaccgctccatctgtcaactctctcagggatttgttccttgaattatgg |
33034839 |
T |
 |
| Q |
145 |
cgggtcgatcgcgttagattcaagatcggaagttagtgtcgagttcagtattttgtttgtttgttatg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
33034838 |
tgggtcgatcgcgttagattcaagatcggaagttagtgtctacttcagtattttgtttgtttgttatg |
33034771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University