View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9661A_low_226 (Length: 210)
Name: NF9661A_low_226
Description: NF9661A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9661A_low_226 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 12122179 - 12122388
Alignment:
| Q |
1 |
ggctgccataatttgttactgggacccacagacctcaacccagagattctaaaccctaattttatcgtagaagattctcgatctttctggaggcatttcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12122179 |
ggctgccataatttgttactgggacccacagacctcaacccagagattctaaaccctaattttatcgtagaagattctcgatctttctggaggcatttcc |
12122278 |
T |
|
| Q |
101 |
gaatgtaatcttcggaggattgagggtgccatgttcgagaaccaatcttgatgtcgacgacagcggcgttggtgtaattggagacaatatcttctaagat |
200 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12122279 |
gaatataatcttcggaggattgaggttgccatgttcgagaaccaatcttgatgtcgacgacagcggcgttggtgtaattggagacaatatcttctaagat |
12122378 |
T |
|
| Q |
201 |
aaggtggggg |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
12122379 |
aaggtggggg |
12122388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 14691698 - 14691907
Alignment:
| Q |
1 |
ggctgccataatttgttactgggacccacagacctcaacccagagattctaaaccctaattttatcgtagaagattctcgatctttctggaggcatttcc |
100 |
Q |
| |
|
||||||||||||| ||| |||||||||| |||||||| || |||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
14691698 |
ggctgccataattgattagtgggacccactgacctcaaaccggagattctaaaccctaatttgatactagaagattctcgatctttctggaggcatttcc |
14691797 |
T |
|
| Q |
101 |
gaatgtaatcttcggaggattgagggtgccatgttcgagaaccaatcttgatgtcgacgacagcggcgttggtgtaattggagacaatatcttctaagat |
200 |
Q |
| |
|
| ||||||||||| ||||| || |||||||||||||| ||||| ||||||||||||||||| || | ||||||||||||| |||||| |||||||||| |
|
|
| T |
14691798 |
ggatgtaatcttcagaggactgtgggtgccatgttcgtgaaccgatcttgatgtcgacgacggcagggttggtgtaattgctgacaatgtcttctaagac |
14691897 |
T |
|
| Q |
201 |
aaggtggggg |
210 |
Q |
| |
|
||||||||| |
|
|
| T |
14691898 |
gaggtggggg |
14691907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University