View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9661A_low_232 (Length: 208)
Name: NF9661A_low_232
Description: NF9661A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9661A_low_232 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 6917635 - 6917429
Alignment:
| Q |
1 |
gtgcatttagcattttatattgagtttgctcaaacaacaagcaaaaggaaaatcagaccctatatgtttcggaatcaacctcgccgcgctcaatcttgat |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6917635 |
gtgcatttagcattttatattgagtgtgctcaaacaacaagcaaatggaaaatcagaacctatatgtttcgaaatcaacctcgccgcgctcaatcttgat |
6917536 |
T |
|
| Q |
101 |
ggcctggaacttgcctttctggacagttgtgacctctgtatggggagcgaagtgctcccggcttcaaactcgtctccggatagtacctgtttcctgttgc |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6917535 |
ggcctggaacttgccattctggacagttgtgacctctgtatggggagcgaagtgctcccggcttcaaactcgtctccggatagtacctgttccctgttgc |
6917436 |
T |
|
| Q |
201 |
agaactg |
207 |
Q |
| |
|
||||||| |
|
|
| T |
6917435 |
agaactg |
6917429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University